| JOURNAL HOME | CME HOME | THIS MONTH | PAST ISSUES | ETOC | COLLECTIONS |
| AUTHORS | REVIEWERS | EDITORIAL BOARD | FEEDBACK | RSS | HELP |
 
|
|
|
||
|
|
Anesth Analg 2007;104:624-630 © 2007 International Anesthesia Research Society doi: 10.1213/01.ane.0000250366.48705.96
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
Abstract |
|---|
 Top Abstract IntroductionMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
BACKGROUND: Intravascular volume therapy is crucial in septic patients to improve tissue perfusion and maintain stable hemodynamics. Modified fluid gelatins (MFG) and medium weight hydroxyethyl starches (HES) are the most widely used synthetic colloids. Our aim in this study, performed in septic rats challenged by cecal ligation and puncture (CLP), was to investigate the effects of HES and MFG on pulmonary capillary leakage and to determine whether an antiinflammatory mechanism was involved.
METHODS: Animals were randomly allocated to eight groups: saline control; CLP and saline; CLP and HES (7.5, 15, and 30 mL/kg); CLP and MFG (7.5, 15, and 30 mL/kg). Each group had 20 rats, 10 of which were used for pulmonary capillary leakage and 10 for other measurements. Four hours after CLP, the specified doses of HES or MFG were infused. Six hours after surgery, pulmonary capillary leakage, levels of tumor necrosis factor-
, interleukin-1ß, and macrophage inflammatory protein-2, intercellular adhesion molecule-1 mRNA expression, myeloperoxidase activity, lung histological changes, and nuclear factor-
B activation were measured.
RESULTS: HES and MFG significantly attenuated the increase in capillary leakage in a dose-dependent manner. In addition, HES could decrease tumor necrosis factor-, interleukin-1ß, and macrophage inflammatory protein-2 expression, intercellular adhesion molecule-1 mRNA expression, myeloperoxidase activity, neutrophil infiltration, and nuclear factor-B activation, whereas MFG could not.
CONCLUSIONS: HES may attenuate capillary leakage by modulating an inflammatory response, whereas an antiinflammatory mechanism was not involved in the effects of MFG on capillary leakage.
|
Introduction |
|---|
|
TopAbstractIntroductionMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Sepsis and septic shock, the most frequent causes of death in intensive care units, are associated with both a relative and an absolute intravascular volume deficit (1). These deficits cause deterioration in tissue perfusion and organ oxygenation. Intravascular volume therapy is of vital importance in the treatment of the septic patients to improve tissue malperfusion and maintain stable hemodynamics. However, which kind of intravascular volume therapy is best suited for sepsis is a subject of continuing controversy. At the same time, there is also debate over which colloid should be used (2). Gelatins and medium weight hydroxyethyl starches (HES) are the most widely used synthetic colloids in Europe.
The plasma volume-expanding properties of a colloid can be attributed to many physical factors, such as molecular size, molecular charge, and colloid osmotic pressure (3). Using a porcine septic shock model with concomitant capillary leakage syndrome, Marx et al. (4) found that the artificial colloids HES, modified fluid gelatin (MFG) 4%, and MFG 8% maintained plasma volume and colloid osmotic pressure. It has even been suggested that HES reduces capillary leakage by a direct sealing effect (5). Moreover, previous studies in our laboratory (6) have indicated that HES 200/0.5 could attenuate an inflammatory response in the lung, heart, and liver during endotoxemia and sepsis, suggesting that colloids have antiinflammatory effects on capillary leakage. Despite there being numerous studies, only a few have compared the role of different intravascular volume replacement regimens in capillary leakage or have investigated whether an antiinflammatory mechanism is involved.
Inflammatory cascading reactions, including a variety of mediators that occur in sepsis, e.g., tumor necrosis factor (TNF-), interleukin (IL)-1ß, macrophage inflammatory protein-2 (MIP-2), and intercellular adhesion molecule-1 (ICAM-1), induce increased capillary leakage, which in turn results in interstitial fluid accumulation, loss of protein, and tissue edema (7).
The aim of our study was to compare the effects of 4% MFG and HES (mean molecular 130 kDa, substitution ratio 0.4) on pulmonary capillary leakage associated with sepsis induced by cecal ligation and puncture (CLP), and to investigate whether they exhibit beneficial effects by modulating inflammatory mediators.
|
METHODS |
|---|
|
TopAbstractIntroductionMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Adult male Sprague Dawley rats weighing 250–320 g were housed in an approved facility with a 12 h light/12 h dark cycle and were fed with rat chow with free access to tap water before surgery. All procedures were approved by the ethics committee of Nanjing University Medical School and performed in accordance with The Guide for the Care and Use of Laboratory Animals from the National Institutes of Health (NIH Publication No. 85-23, revised 1996).
The rats were randomly assigned to eight groups: saline control (30 mL/kg); CLP and saline (30 mL/kg); CLP and HES (7.5, 15, and 30 mL/kg); CLP and MFG (7.5, 15, and 30 mL/kg). Each group had 20 rats, 10 of which were used for pulmonary capillary leakage and 10 for other measurements.
Animals were anesthetized with 2% sodium pentobarbital in saline (40 mg/kg, IP; Sigma Chemical, St. Louis, MO). The left carotid artery was cannulated with a microtip transducer for continuous recording of the macrohemodynamic variables, mean arterial blood pressure (MAP), and heart rate (HR) during the course of experiment. A tail vein was catheterized to administer saline and various doses of HES or MFG.
Baseline (0 min) hemodynamic variables were recorded before the experiment. CLP was subsequently performed using a 20-gauge needle and double puncture technique, as previously described, with minor modifications (8). Briefly, an approximately 2 cm midline incision was made in the abdomen. The cecum was isolated carefully and then ligated at about 20% of the total length just below the ileocecal valve to avoid bowel obstruction. The cecum was punctured twice on the antimesenteric side with a sterile 20-gauge needle and was then gently squeezed to extrude the fecal material into the peritoneal cavity. Then, cecum was placed back in the abdomen, and the incision was closed in two layers with sutures. All rats were then resuscitated with 1 mL of saline injected subcutaneously. Sham-operated controls were treated in a similar manner, but without ligation and puncture.
Four hours after CLP, each group was treated with 0.9% normal saline solution or different doses of HES (HAES-steril 130/0.4, 6%, Fresenius Kabi, Bad Homberg, Germany) or MFG (Gelofusine, 4%, B Braun, Melsungen, Germany) via the tail vein. Animals were killed 6 h after the operation, and the lungs were harvested for subsequent measurements.
Pulmonary capillary leakage was determined with the Evans blue dye extravasation method. Two percent Evans blue (20 mg/kg; Sigma Chemical CO) was injected IV via the tail vein 15 min before death. The lung tissues were excised and weighed. To each sample of tissues, 4.0 mL formamide was added and incubated at 37°C for 24 h. If necessary, the incubation time was prolonged, until the blue color of the samples completely disappeared. After filtration with a glass filter, the absorbance of the filtrate was measured at 620 nm in a Beckman spectrophotometer. The total amount of dye can be calculated by means of a standard calibration curve. Microvascular permeability in the lungs was shown as the µg of Evans blue in every mg of tissue.
The pulmonary levels of inflammatory cytokines/ chemokine were quantified using specific ELISA kits for rats according to the manufacturers’ instructions (TNF- from Diaclone Research, Besancon, France; IL-1ß and MIP-2 from Biosource Europe SA, Niveiles, Belgium). Values were expressed as pg/mg protein.
To determine ICAM-1 mRNA expression, total RNA was extracted with TriPure Isolation Reagent (Roche Molecular Biochemicals, Rotkreuz, Switzerland) and quantified by absorption at 260 nm. Reverse transcription was implemented using reverse transcription system (Promega, Madison, WI) according to the protocol. We used ß-actin as normalization control. The 5' to 3' sequences of the primers were
ß-actin: CAGAGCAAGAGAGGCATCCTGGCAGCTCATAGCTCTTCTC
ICAM-1: ATGGTCCTCACCTGGACAAG TCCTCTGGCGGTAATAGGTG
A total volume of 100 µL reaction contained 2 µL of reverse transcription product, 1.5 mM MgCl2, 2.5 U Taq DNA polymerase, 100 µM dNTP, 0.1 µM primer and 1x Taq DNA polymerase magnesium-free buffer (Promega, Madison, WI). Then the reaction mixture was overlaid with two drops of mineral oil (Sigma Chemical CO, St. Louis, MO) and incubated in a thermocycler (MiniCycler PTC 150, MJ Research Inc., Waltham, MA) programmed to predenature at 95°C for 2 min, denature at 95°C for 1 min, anneal at 60°C for 1 min and extend at 72°C for 2 min for a total of 33 cycles (ICAM-1/ß-actin). The last cycle was followed by a final incubation at 72°C for 5 min and cooled to 4°C. The polymerase chain reaction products were 535 bp (ß-actin) and 351 bp (ICAM-1), respectively. They were electrophoresed on a 1.5% agarose gel stained with ethidium bromide. The gel was captured as a digital image and analyzed using Scion Image software (Frederick, MD). Values in each sample were normalized with ß-actin control.
Nuclear factor-B (NF-B) activation was determined by electrophoretic mobility shift assay. Briefly, nuclear protein was extracted and quantified as described previously and electrophoretic mobility shift assay was performed using a commercial kit (Gel Shift Assay System; Promega, Madison, WI) following the conventional methods in our laboratory (6).
Myeloperoxidase (MPO) activity in the lungs was determined as an index of tissue neutrophil sequestration. To measure tissue MPO activity, frozen lungs were thawed and extracted for MPO, following the homogenization and sonication procedure as described previously (9). MPO activity in supernatant was measured and calculated from the absorbance (at 460 nm) changes resulting from decomposition of H2O2 in the presence of o-dianisidine.
We chose four groups to observe morphological changes: saline control; CLP and saline (30 mL/kg); CLP and HES (30 mL/kg); CLP and MFG (30 mL/kg). The lungs were evaluated for neutrophil infiltration. Briefly, the lung lobes were fixed in 10% formalin, washed, dehydrated with graded alcohols, and embedded in paraffin. Sections were cut (5 mm thick) and stained with hematoxylin and eosin for light microscopy. Slides were read by a pathologist blinded to the study groups, and scored using a scoring system developed by Simons et al. (10) to grade the degree of lung injury. Briefly, lung injury was graded from 0 (normal) to 4 (severe) in four categories: interstitial inflammation, neutrophil infiltration, congestion, and edema. The total lung injury score was calculated be adding the individual scores for each category.
Data were expressed as mean ± sem. Statistical significance was determined by analysis of variance (ANOVA) followed by Student–Newman–Kuels test as a post hoc test. Differences were considered to be statistically significant if P was <0.05.
|
RESULTS |
|---|
|
TopAbstractIntroductionMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
MAP and HR were comparable at baseline among groups (data not shown). There were no significant differences in the monitored physiological variables (MAP and HR) among the eight animal groups at baseline (0 min) conditions or during 6 h after CLP within groups, and all values were within normal ranges for adult male rats.
The pulmonary capillary leakage was significantly increased by threefold at 6 h after CLP in the lungs (Fig. 1). Except that 7.5 mL/kg MFG showed no significant reduction in this value, HES and MFG significantly decreased it in a dose-dependent manner. Thirty milliliters per kilogram of HES and MFG was the most effective dose.
|
We used MPO activity to study the functional effect of HES on neutrophil influx into the lungs. As shown in Figure 2, MPO levels were significantly increased in the CLP-challenged group. After treatment with HES, MPO activity was markedly inhibited, and the maximal inhibitory effect was observed at 15 mL/kg. However, no significant difference was noted between the CLP plus saline group and the CLP plus MFG groups.
|
CLP-induced sepsis was associated with marked increases in the protein levels of TNF- (Fig. 3A), IL-1ß (Fig. 3B), and MIP-2 (Fig. 3C). HES could significantly suppress TNF-, IL-1ß, and MIP-2 elevation. With respect to these inflammatory markers, 15 mL/kg HES expressed the highest protective effect on IL-1ß, and 30 mL/kg HES inhibited TNF- and MIP-2 the most. MFG at all doses studied could not suppress the expression of these mediators.
|
Compared with the control group, ICAM-1 mRNA expression (Fig. 4) was significantly elevated in the CLP-challenged group. HES markedly decreased ICAM-1 mRNA levels in a dose-dependent manner, whereas MFG displayed no inhibitory effect on ICAM-1. With regard to this mediator, 30 mL/kg HES showed the highest protective effect.
|
As shown in Figure 5, NF-B activation after CLP was significantly enhanced compared with that of the control group. Infusion of HES markedly decreased NF-B activation, especially in the 15 mL/kg group. On the contrary, MFG could not inhibit NF-B activation at any of the investigated doses.
|
Lung histopathology changes are shown in Figure 6A. CLP (Fig. 6A-4 caused lung injury, alveolar collapse, edema, congestion, thickening of the alveolar-capillary membrane, and neutrophil infiltration, which were not observed in the control group (Fig. 6A-1). Thirty milliliter per kilogram HES could alleviate the degree of lung tissue lesion, as shown in Fig. 6A-2; that is, there was less alveolar septal thickening, neutrophil infiltration, edema, and alveolar congestion. MFG had no protective effect on rats challenged with CLP (Fig. 6A-3). The total lung injury score was significantly lower in the CLP plus HES group compared with the CLP plus saline group, whereas there was no marked difference between the CLP plus MFG group and the CLP plus saline group.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
In a polymicrobial sepsis model induced by CLP, we have found that (a) both HES and MFG could attenuate pulmonary capillary leakage; (b) HES could display antiinflammatory effects, as reflected by a reduction of TNF-
, IL-1ß, MIP-2, ICAM-1, MPO activity, lung injury, and NF-B activation, whereas MFG could not; and (c) HES may attenuate capillary leakage by modulating inflammatory mediators, whereas MFG may be related to other mechanisms. Compared with endotoxin administration, polymicrobial sepsis induced by CLP is a more realistic sepsis model that mimics the physiologic changes in human sepsis and allows more rigorous research into the mechanisms and mediators associated with sepsis. The CLP model of acute lung injury secondary to sepsis is characterized by infiltration of neutrophils into the lungs (11).
Systemic capillary leakage, an early sign of inflammation after injury, is proportional to the severity of the insult (12). Our results from HES administration are in agreement with experimental and clinical studies demonstrating that HES is capable of reducing macromolecular leakage during endotoxemia (13). A histology study in the rat limb by Oz et al. (14) showed that various fractions of HES could reduce abnormal microvascular permeability after ischemia and reperfusion. In addition, HES could protect cellular morphology and reduce myocardial water content after myocardial reperfusion injury (15). A previous study demonstrated that HES may directly interact with endothelium, characterized as "plugging the leaks," which is likely to mediate changes in capillary wall permeability (5). In a randomized trial of HES 250/0.45 versus Gelofusine in trauma resuscitation, capillary permeability was lower in the HES-treated patients than in the Gelofusine-treated patients during the first 24 h after admission (16). However, our data demonstrated attenuation of capillary leakage after MFG infusion, and we further investigated whether this effect was associated with an inflammation response.
Activation of inflammatory mediators, including TNF-, IL-1ß, MIP-2, and ICAM-1, is considered to play a major role in the pathogenesis of sepsis. TNF- has been shown to play an important role during CLP-induced septic peritonitis (17). IL-1ß shares many of the same effects as TNF-, including neutrophil recruitment, stimulation of chemokine release, and up-regulation of adhesion molecules (18). Chemokine levels were markedly increased during the course of septic peritonitis after CLP surgery. Furthermore, ICAM-1 has been shown to be a requirement for neutrophil recruitment after lipopolysaccharide insult (19). These results seem to parallel our observations that inflammatory mediators were significantly increased after CLP. The transcriptional regulatory factor NF-B is a central participant in modulating the expression of many of the immunoregulatory mediators involved in animal models of inflammatory diseases (20). We found that NF- activation was increased in CLP-induced sepsis, confirming its important role for directing the transcription of many proinflammatory genes. Neutrophil rolling along the endothelium may initiate a cascade of cellular interactions, resulting in endothelial damage (e.g., capillary leakage) and subsequent development of multiple organ damage (21). Our data showed that MPO activity, a marker for neutrophil influx, was greatly enhanced. Moreover, neutrophil infiltration was directly displayed in histological observation. All these results showed an activated inflammatory response during sepsis.
Our most important finding was that HES could inhibit inflammatory mediators and neutrophil infiltration, whereas MFG could not. When administered during resuscitation of patients who have experienced trauma, 10% HES significantly reduced the expression of plasma endothelial leukocyte adhesion molecules and ICAM, compared with patients who received 20% human serum albumin and pentoxifylline (21). Other apparent antiinflammatory manifestations of HES include reduced neutrophil chemotaxis, decreased microvascular permeability, and attenuation of the neutrophil respiratory burst (22). These studies contribute to the literature regarding the antiinflammatory effects of HES. Our results suggested that HES may exert its protective role in capillary leakage by modulating an inflammatory response.
It has been suggested that the different mechanisms controlling fluid and macromolecular permeability can be attributed to differences in size, charge of the molecules, and route of transport. These mechanisms are biophysical. It has further been suggested that HES molecules may act as a sealant to the leaky capillary pores (5). Our current study demonstrated that HES and MFG may attenuate capillary leakage. As HES has a higher molecular weight than gelatin, it seemed that HES may be more likely to exert its effect on capillary leakage by directly plugging leaky capillary pores. Moreover, HES can decrease inflammatory mediators, neutrophil infiltration, and NF-B activation, indicating that biochemical and cellular mechanisms are involved in its effects on capillary leakage in addition to a biophysical mechanism. MFG, on the other hand, had little beneficial effect on inflammatory response. In an article by Marx et al. (4), the albumin escape rate was found to be higher in animals with sepsis, but no escape of HES or MFG molecules from the circulation could be demonstrated, and both colloids maintained plasma volume. This finding seems to support our results. The reason MFG molecules do not pass the capillary leak is not yet clear. Colloid oncotic pressure and/or changes in the endothelial or subendothelial matrix proteins’ charges could provide the physiological explanation (4). Future studies are needed to uncover the underlying mechanism.
Clinical studies have suggested that early aggressive intravascular volume resuscitation is beneficial in patients with severe sepsis or septic shock (23). There is some evidence that early and aggressive intravascular fluid resuscitation can reduce the inflammatory response and limit capillary leakage (24). In a prospective clinical trial, fluid management reduced extravascular lung water, ventilator days, and intensive care unit days in critically ill patients requiring pulmonary artery catheterization, indicating that intravascular fluid resuscitation remains one of the most important interventions in septic shock (25). Using a porcine septic shock model with concomitant capillary leakage, Marx et al. found that HES could preserve systemic hemodynamics and oxygenation, such as maintaining plasma volume, and could significantly increase cardiac output and tissue oxygenation when compared with Ringer’s solution, administered in the early phase of sepsis (24). It is quite clear in our present observation that HES displayed antiinflammatory effects. However, HES may display a better intravascular volume effect than MFG because of its higher molecular weight. In addition, because hemodynamic evaluation is insufficient and the effects of HES are dose related, it is not certain that the effects are not primarily the result of better global hemodynamic effects. Additional studies are required to test the efficacy of HES on more hemodynamic variables.
Synthetic colloids are widely used in anesthesia and intensive care to preserve a normal intravascular volume. There is, however, debate regarding which synthetic colloid should be used (2,5). HES and MFG were shown to have beneficial effects on capillary leakage in our study. However, HES but not MFG could alleviate an inflammatory response. Despite this, we could not exclude a role of MFG during sepsis. Both substances constitute effective plasma volume therapy to improve tissue perfusion and maintain stable hemodynamics.
Collectively, HES and MFG could attenuate pulmonary capillary leakage in a rat sepsis model induced by CLP. Compared with MFG, HES could decrease inflammatory mediators, suppress neutrophil activation, and inhibit NF- activation. Therefore, HES may attenuate capillary leakage by modulation of an inflammatory response, whereas this is not true of MFG.
|
ACKNOWLEDGMENTS |
|---|
We are grateful to Dr. Feng Genbao and Zhang Xinhua for excellent technical assistance.
|
Footnotes |
|---|
Accepted for publication October 3, 2006.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
- Imm A, Carlson RW. Fluid resuscitation in circulatory shock. Crit Care Clin 1993;9:313–33.[Web of Science][Medline]
- Traylor RJ, Pearl RG. Crystalloid versus colloid: all colloids are not created equal. Anesth Analg 1996;83:209–12.[Web of Science][Medline]
- Webb AR, Barclay SA, Bennett ED. In vitro colloid osmotic pressure of commonly used plasma expanders and substitutes: a study of the diffusibility of colloid molecules. Intensive Care Med 1989;15:116–20.[Web of Science][Medline]
- Marx G, Meyer TC, Schuerholz T, et al. Hydroxyethyl starch and modified fluid gelatine maintain plasma volume in a porcine model of septic shock with capillary leakage. Intensive Care Med 2002;28:629–35.[Web of Science][Medline]
- Vincent JL. Plugging the leaks? New insights into synthetic colloids. Crit Care Med 1991;19:316–18.[Web of Science][Medline]
- Tian J, Lin X, Guan R, Xu JG. The effects of hydroxyethyl starch on lung capillary permeability in endotoxic rats and possible mechanisms. Anesth Analg 2004;98:768–74.
[Abstract/Free Full Text] - Groeneveld AB, Bronsveld W, Thijs LG. Hemodynamic determinants of mortality in human septic shock. Surgery 1986;99:140–53.[Web of Science][Medline]
- Singleton KD, Wischmeyer PE. Distance of cecum ligated influences mortality, tumor necrosis factor- and interleukin-6 expression following cecal ligation and puncture in the rat. Eur Surg Res 2003;35:486–91.[Web of Science][Medline]
- Yang J, Li W, Duan M, et al. Large dose ketamine inhibits lipopolysaccharide-induced acute lung injury in rats. Inflamm Res 2005;54:133–7.[Web of Science][Medline]
- Simons RK, Maier RV, Chi EY. Pulmonary effects of continuous endotoxin infusion in the rat. Circ Shock 1991;33:233–43.[Web of Science][Medline]
- Czermak BJ, Breckwoldt M, Ravage ZB, et al. Mechanisms of enhanced lung injury during sepsis. Am J Pathol 1999;154:1057–65.
[Abstract/Free Full Text] - Gosling P. Prevention of post-traumatic clinical capillary leak syndrome. Trauma 1999;1:91–103.
[Abstract/Free Full Text] - Hoffmann JN, Vollmar B, Laschke MW, et al. Hydroxyethyl starch (130 kD), but not crystalloid volume support, improves microcirculation during normotensive endotoxemia. Anesthesiology 2002;97:460–70.[Web of Science][Medline]
- Oz MC, Fitzpatrick MF, Zikria BA, et al. Attenuation of microvascular permeability dysfunction in postischemic striated muscle by hydroxyethyl starch. Microvasc Res 1995;50:71–9.[Web of Science][Medline]
- Zikria BA, Subbarao C, Oz MC, et al. Hydroxyethyl starch macromolecules reduce myocardial reperfusion injury. Arch Surg 1990;125:930–4.
[Abstract/Free Full Text] - Allison KP, Gosling P, Jones S, et al. Randomised trial of hydroxyethyl starch versus gelatine for trauma resuscitation. J Trauma 1999;47:1114–21.[Web of Science][Medline]
- Echtenacher B, Mannel DN, Hultner L. Critical protective role of mast cells in a model of acute septic peritonitis. Nature 1996;381:75–7.[Medline]
- Ishida Y, Kondo T, Kimura A, et al. Absence of IL-1 receptor antagonist impaired wound healing along with aberrant NF-B activation and a reciprocal suppression of TGF-ß signal pathway. J Immunol 2006;176:5598–606.
[Abstract/Free Full Text] - Panes J, Perry M, Granger DN. Leukocyte-endothelial cell adhesion: avenues for therapeutic intervention. Br J Pharmacol 1999;126:537–50.[Web of Science][Medline]
- Woronicz JD, Cao X, Cao Z, et al. IB Kinase-ß: NF-B activation and complex formation with IB kinase- and NIK. Science 1997;278:866–9.
[Abstract/Free Full Text] - Boldt J, Heesen M, Padberg W, et al. The influence of volume therapy and pentoxifylline infusion on circulating adhesion molecules in trauma patients. Anaesthesia 1996;51:529–35.[Web of Science][Medline]
- Jaeger K, Heine J, Ruschulte H, et al. Effects of colloidal resuscitation fluids on the neutrophil respiratory burst. Transfusion 2001;41:1064–8.[Web of Science][Medline]
- Rivers E, Nguyen B, Havstad S, et al. Early Goal-Directed Therapy Collaborative Group. Early goal-directed therapy in the treatment of severe sepsis and septic shock. N Engl J Med 2001;345:1368–77.
[Abstract/Free Full Text] - Marx G, Pedder S, Smith L, et al. Resuscitation from septic shock with capillary leakage: hydroxyethyl starch (130 kd), but not Ringer’s solution maintains plasma volume and systemic oxygenation. Shock 2004;21:336–41.[Web of Science][Medline]
- Mitchell JP, Schuller D, Calandrino FS, Schuster DP. Improved outcome based on fluid management in critically ill patients requiring pulmonary artery catheterization. Am Rev Respir Dis 1992;145:990–8.[Web of Science][Medline]
This article has been cited by other articles:
|
|
 |
|
  H. Jia, X. Feng, W. Li, Y. Hu, Q. Zeng, J. Liu, and J. Xu Recombinant Human Erythropoietin Attenuates Spinal Neuroimmune Activation of Neuropathic Pain in Rats Ann. Clin. Lab. Sci., January 1, 2009; 39(1): 84 - 91. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Boldt, C. Brosch, K. Rohm, A. Lehmann, A. Mengistu, and S. Suttner Is Albumin Administration in Hypoalbuminemic Elderly Cardiac Surgery Patients of Benefit with Regard to Inflammation, Endothelial Activation, and Long-Term Kidney Function? Anesth. Analg., November 1, 2008; 107(5): 1496 - 1503. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Boldt, Ch. Brosch, K. Rohm, M. Papsdorf, and A. Mengistu Comparison of the effects of gelatin and a modern hydroxyethyl starch solution on renal function and inflammatory response in elderly cardiac surgery patients Br. J. Anaesth., April 1, 2008; 100(4): 457 - 464. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-L. Vincent The Pros and Cons of Hydroxyethyl Starch Solutions Anesth. Analg., March 1, 2007; 104(3): 484 - 486. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
