Anesth Analg 2004;98:1566-1573
© 2004 International Anesthesia Research Society
doi: 10.1213/01.ANE.0000113235.88534.48
PAIN MEDICINE
The Effects of Local Pentoxifylline and Propentofylline Treatment on Formalin-Induced Pain and Tumor Necrosis Factor-
Messenger RNA Levels in the Inflamed Tissue of the Rat Paw
Magdalena Dorazil-Dudzik, PhD*,
Joanna Mika, PhD
,
,
Martin K.- H. Schafer, MD,
Yanzhang Li, MSc,
Ilona Obara, MSc,
Jerzy Wordliczek, PhD*, and
Barbara Przew
ocka, PhD
*Department of Anaesthesiology and Intensive Care, Jagiellonian University, Kraków, Poland;
Department of Molecular Neuropharmacology, Institute of Pharmacology, Polish Academy of Sciences, Kraków, Poland; and
Department of Molecular Neuroscience, Institute of Anatomy and Cell Biology, Philipps University, Marburg, Germany
Address correspondence and reprint requests to B. Przewocka, PhD, Department of Molecular Neuropharmacology, Institute of Pharmacology, Polish Academy of Sciences, 12 Smetna St., 31-343 Krakow, Poland. Address e-mail to przebar{at}if-pan.krakow.pl
 |
Abstract
|
|---|
We sought to determine whether local administration of pentoxifylline (PTF) or propentofylline (PPTF), which hinders cytokine production, influences pain threshold and formalin-induced pain behavior in rats or the level of tumor necrosis factor-
(TNF-) messenger RNA (mRNA) concentrations in the inflamed paw tissue. PTF (0.5, 1, or 2 mg) and PPTF (1 or 2 mg) injected intraplantarly (i.pl.) had no significant effect on pain threshold. Injection of 0.1 mL of a 12% formalin solution subcutaneously into the dorsal surface of the left hindpaw induced pain behavior (47.6 ± 4.6 incidents per 5 min), and PTF injected at doses of 1 and 2 mg/100 µL i.pl. before (but not after) formalin was effective in antagonizing (33.6 ± 2.5 and 23.6 ± 3.4 incidents per 5 min, respectively) formalin-induced pain behavior. A similar antagonistic effect was observed after PPTF treatment at a dose of 2 mg/100 µL; however, in contrast to PTF, at a later time point (85–90 min) after the formalin challenge, this effect was independent of the scheme of PPTF administration, before or after formalin. The effect of PTF on formalin-induced pain behavior did not parallel paw volume as measured by plethysmometer; however, PTF per se significantly increased the paw volume. Formalin injection significantly increased the TNF- mRNA level in the inflamed tissue of the rat hind paw (150%). PTF administered before, but not after, formalin significantly antagonized (by approximately 40%) the observed increase in the level of TNF- mRNA. Our study demonstrates and provides biochemical evidence that preemptive inhibition of proinflammatory cytokine synthesis by the use of PTF and PPTF, phosphodiesterase, and glial activation inhibitors is useful in antagonizing hyperalgesia in formalin-induced pain. Moreover, local administration of PTF may be a valuable approach to the treatment of inflammatory pain.
IMPLICATIONS: This study demonstrates and provides biochemical evidence that preemptive inhibition of proinflammatory cytokine synthesis by local administration of pentoxifylline and propentofylline is useful in antagonizing hyperalgesia in formalin-induced pain. Moreover, local administration of pentoxifylline could be regarded as a valid approach to the treatment of inflammatory pain.
|
Introduction
|
|---|
Tissue injury induces a cascade of cellular reactions in the lesion area. There is an accompanying release of proinflammatory cytokines—such as tumor necrosis factor- (TNF-), interleukin (IL)-1ß, IL-6, IL-8, and other substances—which is followed by subsequent inflammatory reactions (1–5). Further, cytokines induce the release of pain mediators, such as bradykinin (6) and calcitonin gene-related peptide (7), and activate vagal afferents (8). Thus, by the release of cytokines, injury can produce a long-lasting hyperalgesia. In the formalin test, an experimental model of hyperalgesia, two sensitization mechanisms operate: in the first phase, sensitization occurs peripherally, whereas in the second phase, it occurs centrally. Cytokines are probably important mediators in both phases. After traumatic injury of the nervous system, robust glial reaction is observed, and activated astrocytes and microglia release proinflammatory cytokines, such as TNF-, IL-1, and IL-6. Propentofylline (PPTF) and pentoxifylline (PTF) are methylxanthine derivatives and inhibitors of phosphodiesterase that inhibit lumbar spinal microglial activation. These drugs inhibit TNF- production by blocking the transcription of the gene responsible for TNF- synthesis. As nonspecific phosphodiesterase inactivators, they increase the cyclic adenosine monophosphate (cAMP) level in the cells, thereby inhibiting the synthesis not only of TNF-, but also of IL-1ß, IL-6, and IL-8 (9–12).
In our previous study (13), we demonstrated the antinociceptive activity of PTF after its intraperitoneal (IP) administration, but because of the adverse reactions (such as hypotension, dysrhythmia, sleepiness, agitation, and convulsions) sometimes observed in clinical practice after systemic PTF treatment, local PTF administration seems to be more beneficial to therapy. Therefore, the aim of this study was to determine whether local administration of PTF or PPTF influences formalin-induced behavior in rats and whether this process after the administration of PTF correlates with TNF- synthesis. We used a nociceptive threshold test, assessment of pain behavior in a formalin model of inflammatory pain, and a quantitative in situ hybridization method to determine the level of TNF- messenger RNA (mRNA) in the inflamed paw tissue to clarify these problems.
|
Methods
|
|---|
All experiments were performed according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the local bioethics committee. Male Wistar rats weighing 250–320 g were housed in groups of eight to a cage under a constant light/dark cycle (lights on between 8:00 AM and 8:00 PM) with unrestricted access to food and water.
In the first experiment, the nociceptive threshold for mechanical stimuli was evaluated 10, 25, 40, 55, 70, and 90 min after intraplantar (i.pl.) PTF or PPTF administration by using the Basile Analgesy meter (Ugo Basile, Varese, Italy). The paw pressure method consists of application of a force that increases at a constant rate (a certain number of grams per second). This force is continuously monitored by a pointer that moves along a linear scale. The animal’s paw is placed between plinth and pusher. When the pedal is depressed, the motor starts, thereby rotating a screw that moves the slide along the scale. The force applied to the paw by the pusher increases at a constant rate and is read on the scale (calibrated in grams) at the moment of paw withdrawal. The cutoff pressure was 400 g. The measurements were performed 3 times at 15-s intervals, and their mean was used for calculations.
In second set of experiments, a formalin test was used to mimic the nociceptive stimulation that takes place during surgical procedures. The rats were lightly anesthetized with halothane (1%–2% vol/vol for approximately 2–3 min), and 0.1 mL of a 12% formalin solution was injected subcutaneously into the dorsal surface of the left hindpaw (14,15). The influence of PTF (0.5, 1.0, or 2.0 mg/100 µL; 8–10 rats for each dose) or PPTF (1.0 or 2.0 mg/100 µL; 8–10 rats for each dose) injected i.pl. 10 min before or 10 min after formalin administration was quantified by a qualified investigator (other than the one who made injections) by counting spontaneous flinches, shakes, and jerks of the formalin-injected paw. All such behaviors are referred to as pain behavior in the text. Pain reactions were continuously counted for each animal for 90 min and then totaled over characteristic periods: 2–10 min (first phase) and 30–35 min and 85–90 min (second phase) after formalin administration.
The volume of the rat paw was measured by a plethysmometer (Ugo Basile). PTF was injected 10 min before or 10 min after formalin administration. The measurements were made 30 min after formalin injection.
In the third set of experiments, the influence of i.pl. administration of PTF (2.0 mg/100 µL; three to four rats for each dose and time point) 10 min before and 10 min after formalin administration on the level of TNF- mRNA was measured by in situ hybridization. Rats were killed by decapitation 30, 60, or 90 min after formalin (or saline) administration, and the tissue of the injected paw was taken, frozen on dry ice, cut into 12-µm-thick slices on a cryostatic microtome (Leica Microsystems, Nussloch GmbH, Germany), and processed for in situ hybridization.
For preparation of the primers, rats were injected IP with lipopolysaccharide 500 µg/kg (serotype O127:B8; Sigma, Munich, Germany; 1 mg/mL in phosphate-buffered saline [PBS]). All rats were killed by exposure to CO2 1 h after the injection, and their spleens were rapidly removed and frozen immediately in liquid nitrogen for RNA extraction. RNA was isolated by using TRIzol reagent according to the manufacturer’s protocol. Total RNA was incubated with ribonuclease-free deoxyribonuclease I at 37°C for 30 min and purified with an RNeasy Mini Kit (Qiagen, Hilden, Germany). Complementary DNA (cDNA) was synthesized with SuperScript II ribonuclease H– reverse transcriptase (Gibco BRL, Karlsruhe, Germany) in a total volume of 20 µL. Deoxyribonuclease I-treated total RNA was incubated with oligo(dT) 12–18 (1.25 µM; Amersham-Pharmacia Biotech, Freiburg, Germany) in a volume of 11 µL at 70°C for 10 min and cooled on ice for 2 min. The reaction was started by adding dithiothreitol (DTT) (10 mM), reverse transcriptase (200 U), dNTP (500 µM), and first-strand buffer (Gibco BRL); the mixture was incubated at 16°C for 10 min, at 42°C for 1 h, and at 94°C for 5 min to inactivate the enzyme. The cDNA was diluted to 50 µL by adding 30 µL of polymerase chain reaction (PCR) grade water and stored at –20°C. Hot-start PCR was performed on a GeneAmp 9700 cycler by using 5 µL of cDNA in a total volume of 50 µL, containing upper and lower primers (0.2 µM of each), 1x PCR buffer, 1.5 mM MgCl2, 200 µM deoxynucleotide triphosphate solution mixture, and 1 U of AmpliTaq Gold (Roche Diagnostics, Mannheim, Germany). The PCR primers were picked up by using Primer3 (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) online and were synthesized in MWG Biotech, Germany. A 694-base pair TNF- fragment (NM_012675; nucleotides 15–708) was amplified by using the forward primer CATGATCCGAGATGTGGAACT and the reverse primer TCACAGAGCAATGACTCCAAA. The PCR program was set as 1 cycle at 95°C for 5 min; 40 cycles of 30 s at 94°C, 30 s at 58°C, and 30 s at 72°C; and 10 min of extension at 72°C. The PCR products were purified by using a QIAquick PCR Purification Kit (Qiagen) according to the manuals. The purified PCR fragments were ligated with pGEM-T vector (Promega, Mannheim, Germany) and transformed into DH5 Escherichia coli according to manufacturer’s protocol. The plasmids were isolated by using a QIAfilter Plasmid Maxi Kit (Qiagen) and sequenced in Sequence Laboratories Goettingen (Goettingen, Germany) with universal primers T7 and SP6. Sequences were then confirmed by a homology search with BLAST 2.0 (http://www.ncbi.nlm.nih.gov;blast/). The control expression of TNF- was checked in spleen tissue (Fig. 1).
View larger version (53K):
[in this window]
[in a new window]
|
Figure 1. Representative photomicrographs presenting control expression of tumor necrosis factor- in the rat spleen.
|
|
In situ hybridization was performed as described previously (16). Briefly, frozen serial sections were thaw-mounted on adhesive slides and stored at –70°C. All the following steps were performed at room temperature. Tissues were fixed on the slide by immersion in ice-cold 4% phosphate-buffered formaldehyde solution for 1 h and then washed in 10 mM PBS (pH 7.4) three times for 10 min each and once in PBS containing 0.4% Triton X-100. After a short rinse in distilled water, the sections were washed in 0.1 M triethanolamine (pH 8.0) followed by a second wash in 0.1 M triethanolamine (pH 8.0) containing acetic anhydride (0.25% vol/vol) for 10 min at room temperature. After incubation in 2x sodium salt citrate (SSC), sections were dehydrated in graded alcohols (50% and 70%) and air-dried. Radioactive probes were diluted with hybridization buffer (3x SSC, 50 mM NaPO4, 10 mM DTT, 1x Denhardt’s solution, 0.25 g/L yeast tRNA, 10% dextran sulfate, and 50% formamide) to a final concentration of 5 x 104 dpm/µL, and 30–50 µL of hybridization solution was applied to each section; slides were coverslipped and incubated at 60°C for 14 h. Slides were washed in 2x SSC and 1x SSC for 20 min each followed by incubation in ribonuclease buffer (10 mM Tris, pH 8.0, 0.5 M NaCl, and 1 mM EDTA) containing 1 U/mL ribonuclease T1 and 20 µg/mL ribonuclease A at 37°C for 30 min. The slides were washed at room temperature in 1x, 0.5x, and 0.2x SSC for 20 min each, at 60°C in 0.2x SSC for 60 min, and at room temperature in 0.2x SSC and distilled water for 10 min each. The tissue was dehydrated in 50% and 70% 2-propanol.
Analysis of autoradiograms was conducted with the MCID M4 image analysis system (Imaging Res., St. Catharines, Canada). Radiograph autoradiograms (Hyperfilm-ßmax; Amersham-Pharmacia, Uppsala, Sweden) were digitized under constant light and camera conditions, and calibrated densitometry was performed, yielding measurements of relative optical density. The biochemical data are presented as the mean of relative optical density ± SEM (from 30 to 60 sections and 3 to 4 rats per group). Behavioral data are shown as mean ± SEM (from 8 to 10 rats). The results were statistically assessed by analysis of variance. P < 0.05 indicates a significant difference. Intergroup differences were analyzed by a multiple comparison Bonferroni test.
|
Results
|
|---|
PTF (0.5, 1, or 2 mg) injected i.pl. had no significant effect on the pain threshold for mechanical stimuli measured in the paw pressure test at the times studied, as compared neither with the initial measurement nor with the control, saline-treated group. Similarly, local PPTF administration (1 or 2 mg i.pl.) did not influence the nociceptive threshold in this test (Table 1).
View this table:
[in this window]
[in a new window]
|
Table 1. The Effect of Intraplantar Administration of Pentoxifylline (PTF; 0.5, 1.0, or 2.0 mg) and Propentofylline (PPTF; 1.0 or 2.0 mg) Administered to the Hindpaw on the Nociceptive Threshold Investigated in Control (Naive) rats in the Paw Pressure Test
|
|
PTF injected before formalin significantly decreased the formalin-induced pain behavior in the first phase only at the largest dose (data not shown). However, in the second phase, all doses were effective in antagonizing pain behavior, especially in the late period after formalin injection (Fig. 2). PPTF administered before formalin was effective, but only at the largest dose in the second phase, without influencing the first phase.
View larger version (37K):
[in this window]
[in a new window]
|
Figure 2. The effect of intraplantar administration of pentoxifylline (PTF; 0.1, 1.0, or 10 mg) and propentofylline (PPTF; 2.0 mg) 10 min before (empty columns) or 10 min after (hatched columns) the subcutaneous (s.c.) injection of 12% formalin solution into the rat paw on pain behavior measured within different time periods (30–35 min and 85–90 min) after formalin injection. Data are presented as means ± SEM of 8–10 animals per group. *Significant difference in comparison with the formalin-injected group (P < 0.05); #significant difference between the effects of PTF or PPTF administered before and after formalin (P < 0.05; analysis of variance; Bonferroni test).
|
|
In contrast to the effects of PTF administered before formalin, PTF administered after formalin had no influence except for the largest dose, either in the first or second phase. It is interesting to note that PPTF effects were similar independently of the schedule (before or after formalin) of drug administration at the late time point (Fig. 2).
Formalin injection induced a significant increase in the paw volume as measured by plethysmometer 30 min after formalin administration. The increased volume of the paw was also observed after treatment with PTF alone; however, the effect reached 50% of formalin-induced edema. PTF administration did not influence formalin-induced edema, independently of the schedule (before or after formalin) of drug administration (Fig. 3).
View larger version (31K):
[in this window]
[in a new window]
|
Figure 3. The effect of intraplantar administration of pentoxifylline (PTF; 2 mg/100 µL) administered before (PTF/F) or after (F/PTF) formalin (F) on the paw volume measured by plethysmometer. Data are presented as means ± SEM of 8–10 animals per group. *Significant difference in comparison with the control (saline-injected) group (P < 0.05; analysis of variance; Bonferroni test).
|
|
The level of TNF- mRNA in the inflamed tissue of the rat hindpaw was significantly increased 30 min after formalin injection, and a further increase was observed after 60 and 90 min (Figs. 1 and 4A ). PTF administration before, but not after, formalin significantly antagonized the observed formalin-induced increase in the level of TNF- mRNA (Figs. 4B and 5).
View larger version (175K):
[in this window]
[in a new window]
|
Figure 5. Photomicrographs illustrating the level of tumor necrosis factor- messenger RNA in the inflamed tissue of the rat paw in control rats (A, sense; B, antisense), after injection of 12% formalin into the rat paw (C), after intraplantar administration of pentoxifylline (2 mg/100 µL), and 10 min before formalin (D).
|
|
|
Discussion
|
|---|
This study demonstrated that both cytokine inhibitors, having no effect per se on the pain threshold in control rats, showed significant antinociceptive effects after administration to the inflamed paw in rats; however, the effect of PPTF was less pronounced. Sweitzer et al. (17) demonstrated that in response to injection of formalin to the hindpaw, both microglia and astrocytes in the spinal cord exhibited activated phenotypes whereas, on the contrary, spinal administration of the glial metabolic inhibitor, fluorocitrate, attenuated hyperalgesia in a formalin model (18). After formalin administration, a variety of neuroactive substances are released in addition to nitric oxide: glutamate, aspartate, arachidonic acid, and cyclooxygenase products. Astrocytes and microglia can also release IL-1 and TNF-. Besides inhibiting phosphodiesterase and hindering cytokine production, both drugs are inhibitors of glial activation (19). Both of these effects could influence the level of TNF-. In our experiments, in contrast to PPTF, the effect of PTF was observed only when the drug was administered before the injury, inhibiting development of the inflammation by blocking the synthesis of the proinflammatory cytokines. After the injury, when the level of these cytokines was already high, the inhibition of their synthesis was not effective enough. This finding was supported by biochemical study, which showed that a formalin-induced increase in the level of TNF- mRNA was antagonized by PTF only when the drug was injected before formalin. This means that preemptive local PTF administration reduces pain-related behavior induced by experimental inflammation via the inhibition of TNF- synthesis, which was evidenced by a decrease in TNF- mRNA level in the inflamed tissue.
Because more time elapses between abatement of biosynthetic processes and diminution of the functional pool of TNF-, other mechanisms have to be taken into consideration besides inhibition of its synthesis. If the immune cells are the source of TNF-, inhibition of their migration could be responsible for its lower level; therefore, it may be that inhibition of migration of different classes of immune cells (20) or inhibition of glial activation (19) by PTF may also influence TNF- production. In our study, we differentiated the source of neither TNF- nor the migrating cells, but Dominguez-Jimenez et al. (20) demonstrated that a significant reduction in neutrophil chemotaxis by PTF was dose dependent, with a maximal inhibition at 20 minutes. This argument and the main conclusion from the previously mentioned study—that PTF exerts an important downregulatory effect on the main cellular elements of chronic and acute inflammatory cell filtrates—are in agreement with our observations. However, the mast cells can also be a possible source of TNF-. Mast cells may play a key role in initiating an inflammatory cascade; therefore, they can be involved in neuroimmune control of inflammation, and substance P is a possible mediator of this interaction. In vitro experiments demonstrated that mast cells were capable of releasing TNF-, which followed substance P release (21). Hence, the release of the TNF- from mast cells may be activated by substance P, which is released in response to nociceptive stimulation, e.g., after formalin injection. TNF-, together with CXC chemokine macrophage inflammatory protein-2 (the functional analog of human IL-8), released from mast cells, is a factor that also determines the T cell-dependent recruitment of polymorphonuclear leukocytes (22). Thus, the role of preemptive inhibition of TNF- release by PTF may be responsible for the inhibition of inflammatory processes and, in consequence, pain behavior.
Similarly to postoperative pain, inflammation induced by local formalin injection in rats is characterized by two phases of hyperalgesia. The first phase is associated with direct stimulation of nociceptors because of the increased release of such mediators as substance P, bradykinin, and excitatory amino acids. In the second phase, the levels of histamine, prostaglandins, serotonin, and bradykinin are increased, and this leads to the development of a local inflammatory reaction and progressive functional changes in the spinal cord and, subsequently, alterations at higher levels of the nervous system (23,24). The data demonstrating the inhibitory influence of PTF (9–12) and PPTF (19) on production of proinflammatory cytokines justify the hypothesis that the sensitization process in the postoperative period can be modulated by these substances, because TNF- and IL-1ß release is a part of the early response of the body to injury. By activating the cytokine cascade, TNF- plays a crucial role in early phases of hyperalgesia occurring in the course of inflammation (1–2). IL-8 production, induced by TNF-, stimulates the release of catecholamines (noradrenaline and dopamine), which leads to the development of the sympathetic component of hyperalgesia (2). While IL-1 (25) and IL-6 (4) induce synthesis of prostanoids, which are responsible for their inflammatory component. In this study, we used PTF and PPTF to block activation of the cytokine cascade. These compounds were administered into the rat paw before or after the induction of the inflammatory state by local injection of 12% formalin. This study demonstrated that neither substance exhibited any antinociceptive action after local subcutaneous administration into the paw of naive rats, because they did not change pain thresholds, which is in agreement with previous studies conducted by Wordliczek et al. (13). However, local treatment with PTF as preemptive analgesia (i.e., 10 min before the induction of inflammation by formalin injection) dose-dependently decreased pain-related behavior that was more pronounced in the second phase. Inhibition of the first phase could suggest blockade of cytokine release in the tissue, thus preventing the development of peripheral hyperalgesia, whereas alleviation of pain behavior in the second phase, which depends on the changes caused by sensitization at the level of the spinal cord, could indicate suppressed activation of certain cytokines.
A similar effect was obtained with PPTF administration 10 minutes before the induction of inflammation. However, when the actions of PTF and PPTF given 10 minutes before formalin are compared the effect of PTF seems stronger and more clearly dose dependent. The analgesic effect was much weaker and developed in the late second phase when both substances were injected after the induction of inflammation, but in this case, PPTF action was stronger than PTF in antagonizing pain behavior. It is possible that after the nociceptive process had been initiated, the action of these substances was limited only to inhibition of cytokine activation at the level of the spinal cord and that they were unable to reverse peripheral cytokine activation at the injury site once it had been triggered. Differences in PTF and PPTF effects could result from their diverse mechanisms of action. PTF is a nonspecific phosphodiesterase inhibitor that blocks both phosphodiesterase III and IV (26), whereas a PPTF-induced increase in the intracellular cAMP level results mostly from suppression of phosphodiesterase IV (27). In addition, by increasing cAMP levels, PPTF increases expression of the antiinflammatory cytokine IL-10 (28), which decreases TNF- release on the ipsilateral side in models of peripheral nerve injury (29).
Biochemical studies of the mechanism of action of PPTF administered IP and intrathecally (IT) in neuropathic pain models revealed that it significantly decreased the activity of astrocytes and microglia (19), whereas the experiments of Rodella et al. (30) showed that the administration of PTF before formalin reduced the behavioral response parallel to the reduced number of Fos-positive neurons (increased by formalin) in the spinal cord, indicating a significant reduction of neuronal activation in this area.
In our experiment, PTF per se induced edema. The effect of PTF on formalin-induced pain was not related to plasma extravasation, but another mechanism might have been involved. On the one hand, PTF increased plasma extravasation but did not influence the effect of formalin in this test, whereas on the other hand, PTF antagonized formalin-induced pain behavior. This may suggest that PTF influences TNF- production in three possible ways: 1) by inhibition of migration of different classes of immune cells (20), 2) by inhibition of their synthesis, and 3) by inhibition of glial activation. The proinflammatory effect of PTF evidenced by plasma extravasation may be caused by its action on another target (i.e., on vasculature), and such activity of PTF is the main purpose of its recent clinical use. It cannot be excluded, however, that the PTF-induced edema is a consequence of increased release of prostacyclin.
The suppressed release of one cytokine, TNF-, by PTF administration before the induction of inflammation was evidenced by biochemical studies that showed a significant decrease in the TNF- mRNA level in the paw tissue of the group of rats injected i.pl. with PTF before formalin (in comparison with the control animals). This effect was dependent on the time of determination of mRNA level and was strongest at 60 min after the induction of inflammation.
The results of this study are in agreement with our previous experiments (13), in which we measured the serum TNF- level after IP PTF treatment and obtained similar results. PTF was chosen for the study because of a possibility of using it both in animal and clinical studies. It was established in our previous work (13) that IT or IP PTF treatment increased the nociceptive threshold for mechanical stimuli in the formalin test in rats. Preemptive PTF also inhibited pain-related behavior. These findings correlate with a lower serum TNF- level in animals receiving preemptive PTF. Our clinical investigation focused on the influence of preemptive PTF on pain intensity assessed according to visual analog scales, opioid requirements, and serum cytokine levels in the early perioperative period. In a clinical study, PTF was administered IV before elective cholecystectomy. The patients who received preoperative PTF had smaller opioid requirements in the early postoperative period than control individuals. At the same time, serum levels of TNF- and IL6 were less in the PTF-treated group (13). Our previous experimental and clinical studies (13) confirm the hypothesis that it is possible to modulate nociception by preemptive IT or IP administration of a cytokine inhibitor.
In summary, our study demonstrates and provides biochemical evidence that preemptive inhibition of proinflammatory cytokine synthesis by local treatment with PTF and PPTF is useful in antagonizing hyperalgesia in inflammatory pain. Moreover, local administration of PTF could be regarded as a valid approach to the treatment of inflammatory pain.
|
Acknowledgments
|
|---|
This study was supported by Grant 3 P05C 006 23 from the State Committee for Scientific Research, Warszawa, Poland.
|
References
|
|---|
- Gordon JR, Galli SJ. Mast cells as a source of both preformed and immunologically inducible TNF-alpha/cachectin. Nature 1990; 346: 274–6.[Medline]
- Cunha FQ, Poole S, Lorenzetti BB, Ferreira SH. The pivotal role of tumour necrosis factor alpha in the development of inflammatory hyperalgesia. Br J Pharmacol 1992; 107: 660–4.[ISI][Medline]
- Woolf CJ, Allchorne A, Safieh-Garabedian B, Poole S. Cytokines, nerve growth factor and inflammatory hyperalgesia: the contribution of tumour necrosis factor alpha. Br J Pharmacol 1997; 121: 417–24.[ISI][Medline]
- Oka T, Oka K, Hosoi M, Hori T. Intracerebroventricular injection of interleukin-6 induces thermal hyperalgesia in rats. Brain Res 1995; 692: 123–8.[ISI][Medline]
- Watkins LR, Goehler LE, Relton J, et al. Mechanisms of tumor necrosis factor-alpha (TNF-alpha) hyperalgesia. Brain Res 1995; 692: 244–50.[ISI][Medline]
- Perkins MN, Kelly D, Davis AJ. Bradykinin B1 and B2 receptor mechanisms and cytokine-induced hyperalgesia in the rat. Can J Physiol Pharmacol 1995; 73: 832–6.[ISI][Medline]
- Hua XY, Chen P, Fox A, Myers RR. Involvement of cytokines in lipopolysaccharide-induced facilitation of CGRP release from capsaicin-sensitive nerves in the trachea: studies with interleukin-1beta and tumor necrosis factor-alpha. J Neurosci 1996; 16: 4742–8.[Abstract/Free Full Text]
- Watkins LR, Wiertelak EP, Goehler LE, et al. Characterization of cytokine-induced hyperalgesia. Brain Res 1994; 654: 15–26.[ISI][Medline]
- Neuner P, Klosner G, Schauer E, et al. Pentoxifylline in vivo down-regulates the release of IL-1 beta, IL-6, IL-8 and tumour necrosis factor-alpha by human peripheral blood mononuclear cells. Immunology 1994; 83: 262–7.[ISI][Medline]
- Semmler J, Gebert U, Eisenhut T, et al. Xanthine derivatives: comparison between suppression of tumour necrosis factor-alpha production and inhibition of cAMP phosphodiesterase activity. Immunology 1993; 78: 520–5.[ISI][Medline]
- Zabel P, Schade FU, Schlaak M. Inhibition of endogenous TNF formation by pentoxifylline. Immunobiology 1993; 187: 447–63.[ISI][Medline]
- Han J, Thompson P, Beutler B. Dexamethasone and pentoxifylline inhibit endotoxin-induced cachectin/tumor necrosis factor synthesis at separate points in the signaling pathway. J Exp Med 1990; 172: 391–4.[Abstract/Free Full Text]
- Wordliczek J, Szczepanik AM, Banach M, et al. The effect of pentoxifiline on post-injury hyperalgesia in rats and postoperative pain in patients. Life Sci 2000; 66: 155–64.
- Coderre TJ, Fundytus ME, McKenna JE, et al. The formalin test: a validation of the weighted-scores method of behavioural pain rating. Pain 1993; 54: 43–50.[ISI][Medline]
- Goto T, Marota JJ, Crosby G. Nitrous oxide induces preemptive analgesia in the rat that is antagonized by halothane. Anesthesiology 1994; 80: 409–16.[ISI][Medline]
- Schafer MK, Day R, Cullinan WE, et al. Gene expression of prohormone and protein convertases in the rat CNS: a comparative in situ hybridization analysis. J Neurosci 1993; 13: 1258–79.[Abstract]
- Sweitzer SM, Colburn RW, Rutkowski M, DeLeo JA. Acute peripheral inflammation induces moderate glial activation and spinal IL-1ß expression that correlates with pain behavior in the rat. Brain Res 1999; 829: 209–21.[ISI][Medline]
- Watkins LR, Martin D, Ulrich P, et al. Evidence for the involvement of spinal cord glia in subcutaneous formalin induced hyperalgesia in the rat. Pain 1997; 71: 225–35.[ISI][Medline]
- Sweitzer SM, Schubert P, DeLeo JA. Propentofylline, a glial modulating agent, exhibits antiallodynic properties in a rat model of neuropathic pain. J Pharmacol Exp Ther 2001; 297: 1210–7.[Abstract/Free Full Text]
- Dominguez-Jimenez C, Sancho D, Nieto M, et al. Effect of pentoxifylline on polarization and migration of human leukocytes. J Leukoc Biol 2002; 71: 588–96.[Abstract/Free Full Text]
- Cocchiara R, Lampiasi N, Albeggiani G, et al. Mast cell production of TNF-alpha induced by substance P evidence for a modulatory role of substance P-antagonists. J Neuroimmunol 1999; 101: 128–36.[ISI][Medline]
- Biedermann T, Kneilling M, Mailhammer R, et al. Mast cells control neutrophil recruitment during T cell–mediated delayed-type hypersensitivity reactions through tumor necrosis factor and macrophage inflammatory protein 2. J Exp Med 2000; 192: 1441–52.[Abstract/Free Full Text]
- Tjolsen A, Berge O, Hunskaar S, et al. The formalin test: an evaluation of the method. Pain 1992; 51: 5–17.[ISI][Medline]
- Dickenson AH, Sullivan AF. Subcutaneous formalin-induced activity of dorsal horn neurones in the rat: differential response to an intrathecal opiate administered pre or post formalin. Pain 1987; 30: 349–60.[ISI][Medline]
- Herbert MK, Holzer P. Interleukin-1 beta enhances capsaicin-induced neurogenic vasodilatation in the rat skin. Br J Pharmacol 1994; 111: 681–6.[ISI][Medline]
- Otamiri L, Franzen L, Lindmark L, Tagesson C. Increased phospholipase A2 and decreased phospholipase activity in the small intestinal mucosa after ischemia and revascularisation. Gut 1987; 28: 1445–53.[Abstract/Free Full Text]
- Meskini N, Nemoz G, Okyayuz-Baklouti I, et al. Phosphodiesterase inhibitory profile of some related xanthine derivatives pharmacologically active on the peripheral microcirculation. Biochem Pharmacol 1994; 47: 781–8.[ISI][Medline]
- Platzer C, Fritsch E, Elsner T, et al. Cyclic adenosine monophosphate-responsive elements are involved in the transcriptional activation of the human IL-10 gene in monocytic cells. Eur J Immunol 1999; 29: 3098–104.[ISI][Medline]
- Wagner R, Janjigian M, Myers RR. Anti-inflammatory IL-10 therapy in CCI neuropathy decreases thermal hyperalgesia, macrophage recruitment, and endoneurial TNF expression. Pain 1998; 74: 35–42.[ISI][Medline]
- Rodella L, Rezzani R, Gioia M, et al. Expression of Fos immunoreactivity in the rat supraspinal regions following noxious visceral stimulation. Brain Res Bull 1998; 47: 357–66.[ISI][Medline]
Accepted for publication December 1, 2003.
Top
Abstract
Introduction
